contestada

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatgta bottom: atgtactagtaaagtgccttaaagatcgtacat which strand of dna is transcribed and in which direction? i.e. label the 5′ and the 3′ ends of each strand.

Relax

Respuesta :

5’ tacatgatcatttcacggaatttctagcatgta 3’

3’ atgtactagtaaagtgccttaaagatcgtacat 5’


Only one of the two DNA strands serve as a template for transcription. It is called the template strand or antisense strand of DNA and is read by RNA polymerase from the 3' end to the 5' end during transcription (3' → 5'). However, the complementary RNA is created in the opposite direction, in the 5' → 3' direction, matching the sequence of the sense strand.