Seudónimo Seudónimo
  • 13-02-2017
  • Mathematics
contestada

What is the value of the expression “three less than the quotient of ten and a number, increased by six” when n = 2?

Relax

Respuesta :

Аноним Аноним
  • 13-02-2017
So the equation would be 10/N+3-6.
10/2=5 5+3=8 8-6=2. so if you plug in 2, it would make an answer of 2.
Answer Link

Otras preguntas

Can someone please help? Thanks!
David forgot his book, so he had to sit there and do nothing. compound or complex?
1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
9. One number is 7 more than twice another number. The sum of the numbers is 22. What is one of the numbers? O-5 O 10 07 O 17
Find six city locations that are spelled out in the grid? Plzzz I need help and they might be Spanish city’s
Help please the question is in the screenshot
1) A DNA segment, composed of 120 nucleotides, code for a protein molecule. What term accurately identifies that segment? A) centromere B) chromosome C) gene D
look at screenshot, 2 answers!
What does abbreviation vom stand for
Write the equation of a line in slope-intercept form that passes through (0, 7) and has a slope of -23.