RamenDonkey RamenDonkey

14-04-2021
Biology

contestada

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Relax

Respuesta :

officialscripture officialscripture

14-04-2021

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

Answer Link

Otras preguntas

imagine yourself as a reporter of “The Himatpur Times”. Write a report about the recent Earthquake Drill organised in your school.(plsss help)

Add a suffix to the adjective below to create an adverb. thoughtful

list two favortive food to you then explain how the sun's energy to help make those Foods available to you

Match each polynomial expression with its simplification. (3x + 2x -2) + (4x - 2x + 8) (2x + 5) + ( 7x - 10) + (3x - 4) + (4x -6) (4 + 2x3) + (5x3 + 2) (6x2 + 3

Which substance is an example of an element? A) bronze B) copper C) methane D) rust

If you drop a 50 gram piece of metal that has a temperature of 110°Celsius into 1000 grams of water at 25°Celsius, what best describes what would occur? A.) The

3. A. You have $25 in the United States. Imagine you are visiting India in 2013 to check out new products. How much would your $25 be in Indian rupees? (Be sure

Two objects, Object A and Object B, need to be identified. Object A's index of refraction is determined to be 1.77, and Object B's index of refraction is determ

Which of the following best represents the average rate at which the human hair grows? 0.25 inches per second 0.25 meters per hour 0.25 meter per month 0.25 inc

Which question is being asked in this story problem? Mary bought 3 bouquets of flowers on Monday. She paid $5 for each bouquet. On Friday she bought 1 more bou