RamenDonkey
RamenDonkey RamenDonkey
  • 14-04-2021
  • Biology
contestada

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Relax

Respuesta :

addysenseheult addysenseheult
  • 14-04-2021

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

Answer Link

Otras preguntas

PLEASE HELP ME WITH THESE MATH QUESTIONS ASAP! THANK YOU SO SO MUCH! Write as a simplified ratio. 36/24 = Simplify the ratio. 10 to 8 = Simplify the rati
the perimeter of a standard-sized rectangular rug is 84 ft the length is 22 ft longer than the width find the dimensions​
Which of the following inequalities is true when x = 2?
Mr.Henry expected 10 of the students his Drama class to attend the school play.Instead,15 students in his class attended,What percentage more students attended
what is the slope of white equals 5x - 1​
In angle BCD the measure of
How can bugs show is a person has been moved
How does the word desiccate connect to atrophy when it comes to raisins, which are desiccated grapes?
The force needed to lift an object is equal in size to the gravitational force on the object. How much work is done in lifting an object that has a mass of 5 kg
Which shows the numbers ordered from least to greatest?