s689003
s689003 s689003
  • 11-03-2021
  • Biology
contestada

What is the complementary strand of DNA to the one below?
AAACCGTATCCGCGGTATATCGCCGGAAT

Relax

Respuesta :

nsjwjwiaoaosksjja
nsjwjwiaoaosksjja nsjwjwiaoaosksjja
  • 11-03-2021
lick me , tease me , touch me , please me






AHAHA SORRY
Answer Link
yolzz
yolzz yolzz
  • 05-04-2021

Answer:

TTTGGCATAGGCGCCATATAGCGGCCTTA

Answer Link

Otras preguntas

Kuwait was important to Iraq due to the fact that it has lots of what natural resource? A. Gold B. UraniumC. Oil D. Silver​
Which of the following is the least preferable way to refuse when someone offers you drugs at a party? Its "What? Drugs are illegal and you know it. If you ask
how did hunters and gathers live​
Please hurry I just can’t seem to get this idk I’ll attach the picture please help
Which type of scientist studies natural resources like fossil fuels, minerals, and rocks from Earth’s surface? geologist meteorologist astronomer climatologist
solve for x: 8.7 = 5.22 + x
Hesperia Community Center is buying new seating for their building. They want to purchase a combination of stools and chairs. Stools cost $15 and chairs cost $2
alguien mas ama a este dios griego?
A sequence is defined by the recursive function f(n + 1) = one-halff(n). If f(3) = 9 , what is f(1) ? 1 3 27 81
help plz it pe and heath