ereanser ereanser

15-01-2021
Biology

contestada

AGTACTACGTTGCTTAGTGCTAGCTTAGCTATA

How many codons are there in this strand, from left to right?

Relax

Respuesta :

autumnstoddard84 autumnstoddard84

15-01-2021

Answer: should be 11!

Explanation: every 3 letters = a codon
There are 33 codons, divide it by 3 and get 11! Or you can count by 3’s until the end

Answer Link

Otras preguntas

4(a + 2) = 14 – 2(3 – 2a) –2 –1 no solution all real numbers

Neutral atoms of argon, atomic number 18, have the same number of electrons as each of the following items except: Cl- S -2 K+ Ca +2 Ne

witch one is it a,b,c or d

What is the solution set of 2x(x - 1) = 3?

What is a thesis statement?

In what way is the first stage of the prewriting phase distinct from the second stage?A) writing and editing B) brainstorming and writing C) organizing and re

There are 3 measures of music that are played 3 times in a song. If the first measure has 8 notes, the second measure has 16 notes and the third measure has 4 n

What does an employee offer an employer

What is the definition of globalization?

Which quadratic inequality does the graph below represent? NEED TO KNOW BEFORE 14 MINUTES PLZ!!!!