stuannoy stuannoy

15-08-2016
Mathematics

contestada

When calculating the length of an arc, does it matter which unit of measurement you use when measuring the central angle: radians or degrees? Explain your answer.

Relax

Respuesta :

15-08-2016

Hello,

It is due to the fact that 2π rad=360°=400 gr

Answer Link

Otras preguntas

Find the midpoint of the line on the coordinate plane with the given endpoints below. (-1, 1), (5, -5)

Once the light organ is colonized, the squid no longer takes in Vibrio fischeri or other bacteria from the environment. Explain how a sufficiently large populat

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

ACTIVATE Think about an adventure story that you have read. Answer the questions. 1 Who is the author of the story? 2 Is it written in the first person or the t

What makes an interest group powerful

Which of the following is a major goal of fisheries managers? A.Using resources intelligently so they will be preserved. B.Increasing fish production as much as

Indicate which formula you would use to solve for the missing side B and then write your answer correct to two decimal places.Write only the formula down.. Sing

The figure below shows three edge views of a square loop with sides of length ℓ = 0.420 m in a magnetic field of magnitude 2.25 T. Calculate the magnetic flux (

Suppose the probability of two people in your class having the same birthday as 0.50 what are the odds of two people having the same birthday

Examine how the circulatory and respiratory system work together to move oxygen through the body.