
Answer:
The correct answer will be-
3'-TAACGCTTGACGCTCCTGAAG-5'.
Explanation:
DNA replication is the process of the cell which helps the cell to replicate or produce an exact copy of the DNA molecule. This process takes place in the synthesis phase or S-phase of the cell division.
The common way of producing replicated DNA molecule is through "Semi-conservative mode" which produces DNA in which one strand is of parent and another strand is newly synthesized by the complementary base pairing rule purposed by the Erwin Chargaff.
Chargaff rule stated that A will bind to T via double Hydrogen bond and G will bind C via triple hydrogen bond mediated by DNA polymerase enzyme with opposite polarity.
Thus, the new strand will be-
Original strand -5' ATTGCGAACTGCGAGGACTTC 3'
Synthesized strand -3'- TAACGCTTGACGCTCCTGAAG-5'.