Below are the sequences of a gene from two species of ciliates (nucleotides on top with amino acid translation below). Is there evidence that this gene has experienced positive selection? 2b 30 species 1 ATGCTTTTGAAATCGATCGTTCGTTCACATCGATGGATC ame 1 20 30 Species 2 ATGCGTTCGAAGTCGATCGATCGCTCAGATCGATCGATC a. Yes, dn/ds <1, therefore it has experienced positive selectiorn. b. Yes, dn/ds >I, therefore it has experienced positive selection. c. No, dn/ds I, therefore it has not experienced positive selection.

Relax