sharidler sharidler
  • 15-12-2022
  • Biology
contestada

original DNA: TACTTTAATCCCAAATTTACT

DNA: TACTTTAATCCCAAGTTTACT
mRNA: ?
amino acid: ?
what type of mutation is this: ?​

Relax

Respuesta :

Otras preguntas

What is the molarity of 0.50 g of Na dissolved in a 1.5 L solution?
Which of the following is not normally considered an element of culture? a. values and belief systems b. religious practices c. gender roles in society d. r
A circular swimming pool has a diameter of 12 m. What is the approximate circumference of the swimming pool? Use pi star times = 3.14. Express your final answer
If you fall behind on your rent, the owner can enter your property and seize something of value until you are caught up. This right to seizure is called a/an a.
The vice president of the United States, also known as the president of the Senate, usually sponsors the most bills.True Or False
why did many americans seek a change in the election of 1980
como calculo uma conversao de 38 ºF P/ ºC
9/11 = ?/22 I'm stuck now
What is the only means of preserving beauty, according to these lines from William Shakespeare's Sonnet 3? Thou art thy mother's glass, and she in thee Calls ba
some datails about the skunk.